Telomeer

Uit Wikipedia, de vrije encyclopedie
Ga naar: navigatie, zoeken
Chromosomen (grijs) van de mens met aan de uiteinden de telomeren (wit)

Een telomeer bestaat uit deels dubbelstrengig en deels enkelstrengig DNA, ingekapseld in beschermende eiwitten, en zit aan het uiteinde van een chromosoom. Telomeer betekent in het Grieks eindstuk. Een telomeer komt niet voor bij prokaryoten met een ringvormig chromosoom. Oude cellen hebben chromosomen met een korter telomeer dan jonge cellen. Een uitzondering hierop werd echter in 2003 ontdekt bij het Vaal stormvogeltje, waarbij de telomeren bij het ouder worden van de vogel juist in lengte toenemen. Kortere telomeerlengte is al vaak geassocieerd met een hoger risico op kanker en hart- en vaatziekten en verouderingsziekten in het algemeen, maar het is nog onduidelijk of dit een oorzakelijk verband is[bron?].

Een telomeer is te vergelijken met het plastic uiteinde van een veter. Bij iedere deling rafelt het uiteinde een stukje uit en uiteindelijk kan de cel niet meer delen en sterft. Menselijke cellen bereiken dit stadium na zo'n vijftig, zestig delingen. Als de telomeerlengte behouden blijft, kan de cel zich blijven delen zonder dood te gaan. Onder de microscoop is een telomeer zichtbaar als een oplichtend puntje.

Elizabeth Blackburn, Carol Greider en Jack Szostak wonnen in 2009 de Nobelprijs voor de Fysiologie of Geneeskunde voor hun ontdekking van de beschermende werking van telomeren tijdens celdelingen.[1]

T-loop[bewerken]

Een telomeer bestaat uit repeterende stukjes DNA dat de belangrijke genen beschermt tegen het korter worden van de chromosomen. Ook is het telomeer belangrijk voor de stabiliteit van het chromosoom. Bij de mens bestaat het repeterende stukje DNA uit de sequentie TTAGGG en is het telomeer tussen de 3 en 20 kilobasen lang. Tussen het telomeer en de rest van het chromosoom zit nog een stukje dat 100 tot 300 kilobasen lang is. Hierdoor kan het telomeer een soort lasso, T-loop, vormen. De sequentie verschilt per organisme, maar bevat gewoonlijk veel GC (Guanine en Cytosine) nucleotiden.

Telomerase[bewerken]

Tijdens de celdeling wordt het DNA via replicatie verdubbeld. Het enzym DNA-polymerase kan echter het eind van het chromosoom niet repliceren, omdat het voortijdig van het DNA afvalt. Hierdoor worden bij elke celdeling de chromosomen korter. Het enzym telomerase dat een reverse-transcriptase is, kan een telomeer weer langer maken en komt voor in de kiembaancellen die de geslachtscellen maken, stamcellen, kankercellen en protozoa. Telomerase bestaat uit een enzymatisch deel en een RNA deel, de complementaire sequentie.

Verantwoordelijk gen[bewerken]

Het gen dat verantwoordelijk is voor de vorming van telomerase is in 1998 door Geron Corporation in Californië gekloond en ingebracht in cellen. Deze cellen hebben zich twee jaar lang gedeeld zonder enige vorm van veroudering. Ze lijken onsterfelijk te zijn geworden.

DNA-herstelmechanisme[bewerken]

Elke cel beschikt over een DNA-herstelmechanisme dat beschadigd DNA repareert. Als het DNA te veel beschadigd is en niet meer hersteld kan worden, stopt de cel met delen of gaat dood. Als het telomeer 4 kilobasen kort is geworden kan het geen lus meer maken en ziet het DNA-herstelmechanisme het eind van het chromosoom als een gebroken chromosoom waardoor de cel stopt met delen of dood gaat.

Klonen[bewerken]

Bij klonen van cellen vertrekt men van cellen die al kortere telomeren hebben. Het nieuw organisme vertrekt dus met kortere telomeren.

Enkele bekende telomeren sequenties
Groep Organisme Telomeer repeterend stukje DNA (repeat) (5' → 3' richting eind)
Gewervelden Mens, muis, Xenopus TTAGGG
Draadvormende schimmels Neurospora crassa TTAGGG
Slijmzwammen Physarum, Didymium
Dictyostelium
TTAGGG
AG(1-8)
Kinetoplastiden protozoa Trypanosoma, Crithidia TTAGGG
Ciliophora (protozoa) Tetrahymena, Glaucoma
Pantoffeldiertjes
Oxytricha, Stylonychia, Euplotes
TTGGGG
TTGGG(T/G)
TTTTGGGG
Apicomplexan (protozoa) Plasmodium TTAGGG(T/C)
Hogere planten Arabidopsis thaliana TTTAGGG
Groene algen Chlamydomonas TTTTAGGG
Insecten Bombyx mori TTAGG
Rondwormen Ascaris lumbricoides TTAGGC
Celdelende gisten Schizosaccharomyces pombe TTAC(A)(C)G(1-8)
Knopvormende gisten Saccharomyces cerevisiae

Candida glabrata
Candida albicans
Candida tropicalis
Candida maltosa
Candida guillermondii
Candida pseudotropicalis
Kluyveromyces lactis

TGTGGGTGTGGTG (van RNA 'mal' (template))

of G(2-3)(TG)(1-6)T (consensus)
GGGGTCTGGGTGCTG
GGTGTACGGATGTCTAACTTCTT
GGTGTA[C/A]GGATGTCACGATCATT
GGTGTACGGATGCAGACTCGCTT
GGTGTAC
GGTGTACGGATTTGATTAGTTATGT
GGTGTACGGATTTGATTAGGTATGT

Bronnen, noten en/of referenties
  1. NRC Handelsblad, Nobelprijs Geneeskunde voor bescherming chromosomen, 5 oktober 2009